Mcf7 trop2
WebAE00187 to TROP2 was successfully used to stain plasma membranes in cell line MCF7. Recommended concentration: 1-3ug/ml MCF7 with AE00187 Confocal microscopy of … Web12 jan. 2024 · We demonstrated using flow cytometry that the established anti-TROP2 mAb, TrMab-29 (mouse IgG 1 kappa), detected TROP2 in MCF7 breast cancer cell line as well …
Mcf7 trop2
Did you know?
WebImmunogen Tissue, cells or virus corresponding to Human TROP2. Human choriocarcinoma cell line BeWo. Positive control IHC-P: Human placenta tissue. ICC/IF: JEG3 and MCF7 … MCF7 was a kind gift from Dr. James Brooks’s laboratory at Stanford University (Palo Alto, CA). HCC1806 cells were purchased from ATCC. Cells were grown in RPMI supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin, and 1% Glutamax. Cell culture was performed in a 37 °C incubators … Meer weergeven The TMA was purchased from Biomax (BR1505c) including 150 breast invasive ductal carcinoma cores from 75 different patients with duplicate cores per patient. The TMA had information regarding the clinical stages … Meer weergeven Totally, 400 cells/well for MCF7 and 500 cells/well for HCC1806 cell lines were plated in 6-well plates in triplicates and cultured for 12 days with media changing every 3 days. … Meer weergeven FUCRW plasmid was a generous gift from Dr. Owen Witte’s laboratory at the University of California Los Angeles. The FUCRW-Trop2-OV construct generation was … Meer weergeven The generation of Trop2 knockout stable clone with the guide RNA sequence: CACCAGCGTGCGGGCGTTCT by CRISPR/Cas9 system was previously described34. … Meer weergeven
http://www.med-tohoku-antibody.com/file/reference/1-s2.0-S2405580820302120-main.pdf Web4 apr. 2012 · Disease: Invasive breast carcinoma of no special type (NCIt: C4194) Derived from metastatic site: Pleural effusion. Species of origin: Homo sapiens (Human) (NCBI …
WebCHO‑K1 and MCF7/TROP2‑knockout cells. Furthermore, in vivo experiments on CHO/TROP2 and MCF7 xenografts revealed that TrMab‑6 significantly reduced tumor … WebThe MCF7 line retains several characteristics of differentiated mammary epithelium including ability to process estradiol via cytoplasmic estrogen receptors and the capability of …
Web20 feb. 2012 · On the other hand, we found no evidence of tumour-associated TROP2 mutations, nor of TROP2 induction of oncogenic transformation per se. ... MTE 4-14 TROP2 transfectants (2) MCF7 cells and (3) ...
Web16 jul. 2024 · Trop-2 associates with epithelial phenotype of breast and prostate cells. (A, B) Hierarchical clustering (one minus the Spearman rank correlation) of the mRNA … i\u0027m not afraid of deathWeb19 mei 2024 · TROP2 is a 46-kDa type I transmembrane glycoprotein (323 amino acids), which consists of a large extracellular domain (274 amino acids) with four N … net strength checkWebDetection of TROP2 on human breast cancer cell line MCF7. MCF7 cells were treated with 67 nM of the human TROP2 antibody (catalog # MAB650) or mouse IgG2a isotype … i\\u0027m not a gentleman lyricsWeb1 feb. 2024 · Trop2 deal heats up antibody–drug conjugate space in cancer @article{Shaffer2024Trop2DH, title= ... CHO/TROP2 and the three breast cancer cell … i\u0027m not afraid of stormsWebA novel human Fab antibody for Trop2 inhibits breast cancer growth in vitro and in vivo Hong Lin1,2,3,4, Huiling Zhang5, Jun Wang6, Meiping Lu7, Feng Zheng1, Changjun … i\\u0027m not a girl lyricsWeb4 okt. 2024 · Most epithelial cells, including MCF7 cells, also express Trop2, a close relative of EpCAM. Intriguingly, we found that Trop2 depletion led to the exact opposite global … net stretch wrapWebClone 162-46. Flow cytometric analysis of Trop-2. MCF7 cells (Human breast adenocarcinoma; ATCC HTB-22) were incubated with 0.25 µg of the Purified Mouse Anti … netstroom computer